Bioinformatics

Bioinformatics File Formats Explained: FASTA, FASTQ, SAM/BAM, VCF

A practical field guide to the four file formats you'll touch in almost every sequencing pipeline.

4 September 20263 min read

bioinformaticsfile-formatsngs

Every stage of a sequencing pipeline hands off to the next stage through one of a handful of standard file formats. Knowing them by sight saves a lot of confusion.

FASTA - sequences, no quality

The simplest format: a > header line followed by the sequence itself. Used for reference genomes, gene sequences, and protein sequences.

>chr1 example reference fragment
ACGTACGTTGCATGCATGCATGCATGCATGCATGCATGC
GGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

FASTQ - raw reads, with quality scores

The direct output of a sequencer. Each read is four lines: an identifier, the sequence, a + separator, and a quality string (one character per base, encoding confidence via the Phred scale).

@READ_001 length=36
ACGTACGTTGCATGCATGCATGCATGCATGCATGCA
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII

Each quality character maps to a Phred score - roughly, a ! is very low confidence and I is high confidence. A Phred score of 30 means a 1-in-1000 chance that base call is wrong; this is the "Q30" threshold labs commonly report as a quality bar.

SAM / BAM - reads aligned to a reference

Once reads are aligned to a reference genome (with a tool like BWA or Bowtie2), the result is a SAM (Sequence Alignment/Map) file - a tab-delimited text format recording, for every read, where it mapped, how well, and any mismatches. BAM is the same information in a compressed binary form - what you'll actually work with, since SAM files get enormous. CRAM compresses further still by referencing the genome instead of storing every base.

READ_001  0  chr17  41196312  60  36M  *  0  0  ACGTACGT...  IIIIIIII...

Key columns: read name, alignment flag, chromosome, position, mapping quality, and the CIGAR string (36M = 36 bases matched/mismatched with no insertions or deletions).

VCF - the variants themselves

A Variant Call Format file is the end product of variant calling - one line per position where a sample differs from the reference.

#CHROM  POS      ID  REF  ALT  QUAL  FILTER  INFO
chr17   41276045  .   G    A   99    PASS    DP=45;AF=0.5

REF/ALT show the reference and observed base(s), QUAL is the confidence of the call, and INFO carries extra annotation - read depth (DP), allele frequency (AF), and often much more once a tool like VEP or ANNOVAR has run.

The typical hand-off chain