Python for Bioinformatics: Getting Started with Biopython

Biopython is the standard Python library for working with biological data - reading sequence files, running alignments, and querying public databases without hand-rolling parsers for every file format.

Install

pip install biopython

Reading a FASTA file

from Bio import SeqIO
 
for record in SeqIO.parse("genes.fasta", "fasta"):
    print(record.id, len(record.seq))

SeqIO.parse handles the format-specific parsing (FASTA, FASTQ, GenBank, and more all share the same interface), returning SeqRecord objects with the id, description, and sequence.

Basic sequence operations

from Bio.Seq import Seq
 
seq = Seq("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG")
 
print(seq.complement())        # TACCGGTAACATTACCCGGCGACTTTCCCACGGGCTATC
print(seq.reverse_complement())
print(seq.translate())         # translates codons to amino acids

Computing GC content

GC content (the percentage of G and C bases) is a common quick-look statistic - it affects everything from PCR primer design to sequencing bias.

from Bio.SeqUtils import gc_fraction
 
for record in SeqIO.parse("genes.fasta", "fasta"):
    gc = gc_fraction(record.seq) * 100
    print(f"{record.id}: {gc:.1f}% GC")

Querying NCBI directly

Biopython's Entrez module lets you pull sequences straight from NCBI without leaving Python - useful for quickly grabbing a reference sequence by accession number.

from Bio import Entrez, SeqIO
 
Entrez.email = "you@example.com"  # NCBI requires this
handle = Entrez.efetch(db="nucleotide", id="NM_000546", rettype="fasta", retmode="text")
record = SeqIO.read(handle, "fasta")
print(record.description)

Where this fits into a real pipeline

In practice, Biopython is rarely the whole pipeline - it's the glue: parsing intermediate files, reformatting outputs between tools, pulling reference sequences, or writing small custom filters that a general-purpose tool doesn't quite cover. Heavier lifting (alignment, variant calling) usually goes to dedicated command-line tools like BWA or GATK, called from a script or workflow manager.

Further reading

• Biopython official documentation
• Biopython Tutorial and Cookbook (PDF)